class RnaSecondaryStructurePipeline(Pipeline):
"""
RNA secondary structure prediction pipeline using any `ModelWithSecondaryStructureHead`.
Examples:
```python
>>> import multimolecule
>>> from transformers import pipeline
>>> predictor = pipeline("rna-secondary-structure", model="multimolecule/ernierna-ss")
>>> output = predictor("UAGCUUAUCAGACUGAUGUUG")
>>> output["secondary_structure"]
'.....................'
```
Learn more about the basics of using a pipeline in the [pipeline tutorial](../pipeline_tutorial)
This secondary structure prediction pipeline can currently be loaded from [`pipeline`] using the following task
identifier: `"rna-secondary-structure"`.
The models that this pipeline can use are models that have been trained with a RNA secondary structure prediction
objective, which includes the bi-directional models in the library. See the up-to-date list of available models on
[huggingface.co/models](https://huggingface.co/models?filter=rna-secondary-structure).
"""
threshold: float = 0.5
output_contact_map: bool = False
def preprocess(
self, inputs, return_tensors=None, tokenizer_kwargs=None, **preprocess_parameters
) -> Dict[str, GenericTensor]:
if return_tensors is None:
return_tensors = "pt"
if tokenizer_kwargs is None:
tokenizer_kwargs = {}
model_inputs = self.tokenizer(inputs, return_tensors=return_tensors, **tokenizer_kwargs)
return model_inputs
def _forward(self, model_inputs):
model_outputs = self.model(**model_inputs)
model_outputs["input_ids"] = model_inputs["input_ids"]
if len(model_inputs["input_ids"]) > 1 and getattr(self.model, "supports_batch_process", False):
warn(
"The pipeline received a batch of sequences as input.\n"
"Most RNA Secondary Structure models are designed and trained with a single sequence.\n"
"The results may be less reliable in batch processing.\n",
RuntimeWarning,
)
return model_outputs
def _postprocess(self, contact_map: GenericTensor) -> GenericTensor:
if contact_map.ndim == 3:
contact_map = contact_map.squeeze(-1)
if contact_map.ndim != 2:
raise ValueError(
"Expected a 2D contact map of shape (L, L) or a 3D tensor of shape (L, L, 1), "
f"but got shape {tuple(contact_map.shape)}."
)
contact_map.fill_diagonal_(torch.finfo(contact_map.dtype).min)
contact_map = contact_map.sigmoid()
return contact_map
def postprocess(self, model_outputs, threshold: float | None = None, output_contact_map: bool | None = None):
if threshold is None:
threshold = self.threshold
if output_contact_map is None:
output_contact_map = self.output_contact_map
input_ids = model_outputs["input_ids"]
if hasattr(self.model, "postprocess"):
outputs = self.model.postprocess(outputs=model_outputs, input_ids=input_ids).squeeze(-1)
postprocessed = True
else:
if "logits_ss" in model_outputs:
outputs = model_outputs["logits_ss"]
elif "logits" in model_outputs:
outputs = model_outputs["logits"]
else:
raise PipelineException(
"rna-secondary-structure", self.model.base_model_prefix, "Unable to find logits in model outputs."
)
postprocessed = False
if len(input_ids) == 1:
sequence = self.tokenizer.decode(input_ids.squeeze(0), skip_special_tokens=True).replace(" ", "")
contact_map = outputs.squeeze(0)
contact_map = contact_map[: len(sequence), : len(sequence)]
if not postprocessed:
contact_map = self._postprocess(contact_map)
dot_bracket = contact_map_to_dot_bracket(contact_map, unsafe=True, threshold=threshold)
ret = {"sequence": sequence, "secondary_structure": dot_bracket}
if output_contact_map:
ret["contact_map"] = contact_map.detach().cpu().numpy()
return ret
sequences = [i.replace(" ", "") for i in self.tokenizer.batch_decode(input_ids, skip_special_tokens=True)]
results = []
for sequence, contact_map in zip(sequences, outputs):
contact_map = contact_map[: len(sequence), : len(sequence)]
if not postprocessed:
contact_map = self._postprocess(contact_map)
result = {
"sequence": sequence,
"secondary_structure": contact_map_to_dot_bracket(contact_map, unsafe=True, threshold=threshold),
}
if output_contact_map:
result["contact_map"] = contact_map.detach().cpu().numpy()
results.append(result)
return results
def _sanitize_parameters(
self, threshold: float | None = None, output_contact_map: bool | None = None, tokenizer_kwargs=None
):
preprocess_params = {}
if tokenizer_kwargs is not None:
preprocess_params["tokenizer_kwargs"] = tokenizer_kwargs
postprocess_params = {}
if threshold is not None:
postprocess_params["threshold"] = threshold
if threshold >= 1:
raise PipelineException(
"rna-secondary-structure",
self.model.base_model_prefix,
f"Threshold must be less than 1, but got {threshold}.",
)
if threshold <= 0:
raise PipelineException(
"rna-secondary-structure",
self.model.base_model_prefix,
f"Threshold must be greater than 0, but got {threshold}.",
)
if output_contact_map is not None:
if not isinstance(output_contact_map, bool):
raise PipelineException(
"rna-secondary-structure",
self.model.base_model_prefix,
f"output_contact_map must be a boolean, but got {type(output_contact_map)}.",
)
postprocess_params["output_contact_map"] = output_contact_map
return preprocess_params, {}, postprocess_params
def __init__(self, *args, threshold: float | None = None, output_contact_map: bool | None = None, **kwargs):
super().__init__(*args, **kwargs)
if not isinstance(self.model, torch.nn.Module):
raise NotImplementedError("Only PyTorch is supported for RNA secondary structure prediction.")
if threshold is not None:
if threshold >= 1:
raise PipelineException(
"rna-secondary-structure",
self.model.base_model_prefix,
f"Threshold must be less than 1, but got {threshold}.",
)
if threshold <= 0:
raise PipelineException(
"rna-secondary-structure",
self.model.base_model_prefix,
f"Threshold must be greater than 0, but got {threshold}.",
)
self.threshold = threshold
if output_contact_map is not None:
if not isinstance(output_contact_map, bool):
raise PipelineException(
"rna-secondary-structure",
self.model.base_model_prefix,
f"output_contact_map must be a boolean, but got {type(output_contact_map)}.",
)
self.output_contact_map = output_contact_map
def __call__(self, inputs, **kwargs):
"""
Predict the secondary structure of the RNA sequence(s) given as inputs.
Args:
inputs (`str` or `List[str]`):
One or several RNA sequences.
threshold (`float`, *optional*):
The threshold to use for determining if a contact is present or not. If not provided, the default is
`0.5`. The value must be between 0 and 1.
output_contact_map (`bool`, *optional*):
Whether to output the contact map along with the secondary structure. If not provided, the default is
`False`.
Return:
`dict` or `List[dict]`:
Each result comes as a dictionary with the following keys:
- **sequence** (`str`) -- The input RNA sequence.
- **secondary_structure** (`str`) -- The predicted dot-bracket notation string.
- **contact_map** (`np.ndarray`, *optional*) -- The post-processed contact map probabilities.
"""
outputs = super().__call__(inputs, **kwargs)
if isinstance(inputs, list) and len(inputs) == 1:
return outputs[0]
return outputs