跳转至

EternaBench-External

EternaBench-External

EternaBench-External consists of 31 independent RNA datasets from various biological sources, including viral genomes, mRNAs, and synthetic RNAs. These sequences were probed using techniques such as SHAPE-CE, SHAPE-MaP, and DMS-MaP-seq to understand RNA secondary structures under different experimental and biological conditions. This dataset serves as a benchmark for evaluating RNA structure prediction models, with a particular focus on generalization to natural RNA molecules.

Disclaimer

This is an UNOFFICIAL release of the EternaBench-External by Hannah K. Wayment-Steele, et al.

The team releasing EternaBench-External did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.

Dataset Description

This dataset includes RNA sequences from various biological origins, including viral genomes and mRNAs, and covers a wide range of probing methods like SHAPE-CE and icSHAPE. Each dataset entry provides sequence information, reactivity profiles, and RNA secondary structure data. This dataset can be used to examine how RNA structures vary under different conditions and to validate structural predictions for diverse RNA types.

Example Entry

name sequence reactivity seqpos class dataset
Dadonaite,2019 Influenza genome SHAPE(1M7) SSII-Mn(2+) Mut. TTTACCCACAGCTGTGAATT… [0.639309,0.813297,0.622869,…] [7425,7426,7427,…] viral_gRNA Dadonaite,2019

Column Description

  • name: The name of the dataset entry, typically including the experimental setup and biological source.

  • sequence: The nucleotide sequence of the RNA molecule, represented using the standard RNA bases:

    • A: Adenine
    • C: Cytosine
    • G: Guanine
    • U: Uracil
  • reactivity: A list of normalized reactivity values for each nucleotide, representing the likelihood that a nucleotide is unpaired. High reactivity indicates high flexibility (unpaired regions), and low reactivity corresponds to paired or structured regions.

  • seqpos: A list of sequence positions corresponding to each nucleotide in the sequence.

  • class: The type of RNA sequence, can be one of the following:

    • SARS-CoV-2_gRNA
    • mRNA
    • rRNA
    • small RNAs
    • viral_gRNA
  • dataset: The source or reference for the dataset entry, indicating its origin.

Variants

This dataset is available in four variants:

Preprocess

The MultiMolecule team preprocess this dataset by the following steps:

  1. Padding/truncating all chemical measurements to sequence length.

License

This dataset is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

Text Only
SPDX-License-Identifier: AGPL-3.0-or-later

Citation

BibTeX
@article{waymentsteele2022rna,
  author    = {Wayment-Steele, Hannah K and Kladwang, Wipapat and Strom, Alexandra I and Lee, Jeehyung and Treuille, Adrien and Becka, Alex and {Eterna Participants} and Das, Rhiju},
  journal   = {Nature Methods},
  month     = oct,
  number    = 10,
  pages     = {1234--1242},
  publisher = {Springer Science and Business Media LLC},
  title     = {{RNA} secondary structure packages evaluated and improved by high-throughput experiments},
  volume    = 19,
  year      = 2022
}

Note

The artifacts distributed in this repository are part of the MultiMolecule project. If you use MultiMolecule in your research, you must cite the MultiMolecule project as follows:

BibTeX
@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}