跳转至

RNAStrAlign

RNAStrAlign is a comprehensive dataset of RNA sequences and their secondary structures.

RNAStrAlign aggregates data from multiple established RNA structure repositories, covering diverse RNA families such as 5S ribosomal RNA, tRNA, and group I introns.

It is considered complementary to the ArchiveII dataset.

Disclaimer

This is an UNOFFICIAL release of the RNAStrAlign by Zhen Tan, et al.

The team releasing RNAStrAlign did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.

Dataset Description

Example Entry

id sequence secondary_structure family subfamily
16S_rRNA-Actinobacteria-AB002635 ACACAUGCAAGCGAACGUGAUCUCCAGCUUGC… .(((.(((..((..((((.(((((.((....)… 16S_rRNA Actinobacteria

Column Description

  • id: A unique identifier for each RNA entry. This ID is derived from the family and the original .sta file name, and serves as a reference to the specific RNA structure within the dataset.

  • sequence: The nucleotide sequence of the RNA molecule, represented using the standard RNA bases:

    • A: Adenine
    • C: Cytosine
    • G: Guanine
    • U: Uracil
  • secondary_structure: The secondary structure of the RNA represented in dot-bracket notation, using up to three types of symbols to indicate base pairing and unpaired regions, as per bpRNA’s standard:

    • Dots (.): Represent unpaired nucleotides.
    • Parentheses (( and )): Represent base pairs in standard stems (page 1).
  • family: The RNA family to which the sequence belongs, such as 16S rRNA, 5S rRNA, etc.

  • subfamily: A more specific subfamily within the family, such as Actinobacteria for 16S rRNA.

    Not all families have subfamilies, in which case this field will be None.

Variants

This dataset is available in two additional variants:

  • rnastralign: The main RNAStrAlign dataset.
  • rnastralign.512: RNAStrAlign dataset with sequences no longer than 512 nucleotides.
  • rnastralign.1024: RNAStrAlign dataset with sequences no longer than 1024 nucleotides.
  • ArchiveII: A database of RNA secondary with the same families as RNAStrAlign, usually used for testing.
  • bpRNA-spot: Another commonly used database in RNA secondary structures prediction.

License

This dataset is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

Text Only
SPDX-License-Identifier: AGPL-3.0-or-later

Citation

BibTeX
@article{ran2017turbofold,
  author   = {Tan, Zhen and Fu, Yinghan and Sharma, Gaurav and Mathews, David H},
  journal  = {Nucleic Acids Research},
  month    = nov,
  number   = 20,
  pages    = {11570--11581},
  title    = {{TurboFold} {II}: {RNA} structural alignment and secondary structure prediction informed by multiple homologs},
  volume   = 45,
  year     = 2017
}

Note

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

BibTeX
@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}