跳转至

RNA Secondary Structure

RnaSecondaryStructurePipeline

Bases: Pipeline

RNA secondary structure prediction pipeline using any ModelWithSecondaryStructureHead.

Examples:

Python
1
2
3
4
5
6
7
>>> import multimolecule
>>> from transformers import pipeline

>>> predictor = pipeline("rna-secondary-structure", model="multimolecule/ernierna-ss")
>>> output = predictor("UAGCUUAUCAGACUGAUGUUG")
>>> output["secondary_structure"]
'.....................'

Learn more about the basics of using a pipeline in the pipeline tutorial

This secondary structure prediction pipeline can currently be loaded from [pipeline] using the following task identifier: "rna-secondary-structure".

The models that this pipeline can use are models that have been trained with a RNA secondary structure prediction objective, which includes the bi-directional models in the library. See the up-to-date list of available models on huggingface.co/models.

Source code in multimolecule/pipelines/rna_secondary_structure.py
Python
class RnaSecondaryStructurePipeline(Pipeline):
    """
    RNA secondary structure prediction pipeline using any `ModelWithSecondaryStructureHead`.

    Examples:

    ```python
    >>> import multimolecule
    >>> from transformers import pipeline

    >>> predictor = pipeline("rna-secondary-structure", model="multimolecule/ernierna-ss")
    >>> output = predictor("UAGCUUAUCAGACUGAUGUUG")
    >>> output["secondary_structure"]
    '.....................'

    ```

    Learn more about the basics of using a pipeline in the [pipeline tutorial](../pipeline_tutorial)

    This secondary structure prediction pipeline can currently be loaded from [`pipeline`] using the following task
    identifier: `"rna-secondary-structure"`.

    The models that this pipeline can use are models that have been trained with a RNA secondary structure prediction
    objective, which includes the bi-directional models in the library. See the up-to-date list of available models on
    [huggingface.co/models](https://huggingface.co/models?filter=rna-secondary-structure).
    """

    threshold: float = 0.5
    output_contact_map: bool = False
    matching: Matching = "greedy"

    def preprocess(
        self, inputs, return_tensors=None, tokenizer_kwargs=None, **preprocess_parameters
    ) -> Dict[str, GenericTensor]:
        if return_tensors is None:
            return_tensors = "pt"
        if tokenizer_kwargs is None:
            tokenizer_kwargs = {}

        model_inputs = self.tokenizer(inputs, return_tensors=return_tensors, **tokenizer_kwargs)
        return model_inputs

    def _forward(self, model_inputs):
        model_outputs = self.model(**model_inputs)
        model_outputs["input_ids"] = model_inputs["input_ids"]

        if len(model_inputs["input_ids"]) > 1 and not getattr(self.model, "supports_batch_process", False):
            warn(
                "The pipeline received a batch of sequences as input.\n"
                "This RNA secondary-structure model does not declare batch-processing support.\n"
                "The results may be less reliable in batch processing.\n",
                RuntimeWarning,
            )
        return model_outputs

    def _postprocess(self, logits: GenericTensor) -> GenericTensor:
        """Convert pre-activation pairing `logits` to a [0, 1] contact map: mask the diagonal, then sigmoid.

        Applied only to `logits`/`logits_ss` outputs; `contact_map` outputs are already post-sigmoid.
        """
        if logits.ndim == 3:
            logits = logits.squeeze(-1)
        if logits.ndim != 2:
            raise ValueError(
                "Expected a 2D contact map of shape (L, L) or a 3D tensor of shape (L, L, 1), "
                f"but got shape {tuple(logits.shape)}."
            )
        logits.fill_diagonal_(torch.finfo(logits.dtype).min)
        return logits.sigmoid()

    def postprocess(
        self,
        model_outputs,
        threshold: float | None = None,
        output_contact_map: bool | None = None,
        matching: str | None = None,
    ):
        if threshold is None:
            threshold = self.threshold
        if output_contact_map is None:
            output_contact_map = self.output_contact_map
        if matching is None:
            matching = self.matching
        matching = cast(Matching, matching)

        input_ids = model_outputs["input_ids"]
        # Output contract for RNA secondary-structure models:
        #   * `contact_map` (and whatever `model.postprocess` returns) is already in probability space [0, 1]
        #     and is used as-is;
        #   * `logits` / `logits_ss` are pre-activation pairing scores and must be passed through a sigmoid.
        if hasattr(self.model, "postprocess"):
            outputs = self.model.postprocess(outputs=model_outputs, input_ids=input_ids)
            is_logits = False
        elif model_outputs.get("contact_map") is not None:
            outputs = model_outputs["contact_map"]
            is_logits = False
        elif model_outputs.get("logits_ss") is not None:
            outputs = model_outputs["logits_ss"]
            is_logits = True
        elif model_outputs.get("logits") is not None:
            outputs = model_outputs["logits"]
            is_logits = True
        else:
            raise PipelineException(
                "rna-secondary-structure",
                self.model.base_model_prefix,
                "Unable to find a contact map or logits in model outputs.",
            )
        if outputs.ndim == 4 and outputs.shape[-1] == 1:
            outputs = outputs.squeeze(-1)

        if len(input_ids) == 1:
            sequence = self.tokenizer.decode(input_ids.squeeze(0), skip_special_tokens=True).replace(" ", "")
            contact_map = outputs.squeeze(0)
            contact_map = contact_map[: len(sequence), : len(sequence)]
            if is_logits:
                contact_map = self._postprocess(contact_map)
            dot_bracket = contact_map_to_dot_bracket(contact_map, unsafe=True, threshold=threshold, matching=matching)
            ret = {"sequence": sequence, "secondary_structure": dot_bracket}
            if output_contact_map:
                ret["contact_map"] = contact_map.detach().cpu().numpy()
            return ret

        sequences = [i.replace(" ", "") for i in self.tokenizer.batch_decode(input_ids, skip_special_tokens=True)]
        results = []
        for sequence, contact_map in zip(sequences, outputs):
            contact_map = contact_map[: len(sequence), : len(sequence)]
            if is_logits:
                contact_map = self._postprocess(contact_map)
            result = {
                "sequence": sequence,
                "secondary_structure": contact_map_to_dot_bracket(
                    contact_map, unsafe=True, threshold=threshold, matching=matching
                ),
            }
            if output_contact_map:
                result["contact_map"] = contact_map.detach().cpu().numpy()
            results.append(result)
        return results

    def _sanitize_parameters(
        self,
        threshold: float | None = None,
        output_contact_map: bool | None = None,
        matching: str | None = None,
        tokenizer_kwargs=None,
    ):
        preprocess_params = {}

        if tokenizer_kwargs is not None:
            preprocess_params["tokenizer_kwargs"] = tokenizer_kwargs

        postprocess_params: dict[str, Any] = {}

        if threshold is not None:
            postprocess_params["threshold"] = threshold
            if threshold >= 1:
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"Threshold must be less than 1, but got {threshold}.",
                )
            if threshold <= 0:
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"Threshold must be greater than 0, but got {threshold}.",
                )
        if output_contact_map is not None:
            if not isinstance(output_contact_map, bool):
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"output_contact_map must be a boolean, but got {type(output_contact_map)}.",
                )
            postprocess_params["output_contact_map"] = output_contact_map
        if matching is not None:
            if matching not in ("greedy", "blossom"):
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"matching must be 'greedy' or 'blossom', but got {matching!r}.",
                )
            postprocess_params["matching"] = cast(Matching, matching)
        return preprocess_params, {}, postprocess_params

    def __init__(
        self,
        *args,
        threshold: float | None = None,
        output_contact_map: bool | None = None,
        matching: str | None = None,
        **kwargs,
    ):
        super().__init__(*args, **kwargs)
        if not isinstance(self.model, torch.nn.Module):
            raise NotImplementedError("Only PyTorch is supported for RNA secondary structure prediction.")
        if threshold is None:
            threshold = getattr(getattr(self.model, "config", None), "threshold", None)
        if threshold is not None:
            if threshold >= 1:
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"Threshold must be less than 1, but got {threshold}.",
                )
            if threshold <= 0:
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"Threshold must be greater than 0, but got {threshold}.",
                )
            self.threshold = threshold
        if output_contact_map is not None:
            if not isinstance(output_contact_map, bool):
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"output_contact_map must be a boolean, but got {type(output_contact_map)}.",
                )
            self.output_contact_map = output_contact_map
        if matching is not None:
            if matching not in ("greedy", "blossom"):
                raise PipelineException(
                    "rna-secondary-structure",
                    self.model.base_model_prefix,
                    f"matching must be 'greedy' or 'blossom', but got {matching!r}.",
                )
            self.matching = cast(Matching, matching)

    def __call__(self, inputs, **kwargs):
        """
        Predict the secondary structure of the RNA sequence(s) given as inputs.

        Args:
            inputs (`str` or `List[str]`):
                One or several RNA sequences.
            threshold (`float`, *optional*):
                The threshold to use for determining if a contact is present or not. If not provided, the default is
                `0.5`. The value must be between 0 and 1.
            output_contact_map (`bool`, *optional*):
                Whether to output the contact map along with the secondary structure. If not provided, the default is
                `False`.
            matching (`str`, *optional*):
                Conflict resolver for bases with multiple candidate partners: `"greedy"` (default) or `"blossom"`.

        Return:
            `dict` or `List[dict]`:
                Each result comes as a dictionary with the following keys:

                - **sequence** (`str`) -- The input RNA sequence.
                - **secondary_structure** (`str`) -- The predicted dot-bracket notation string.
                - **contact_map** (`np.ndarray`, *optional*) -- The post-processed contact map probabilities.
        """
        outputs = super().__call__(inputs, **kwargs)
        if isinstance(inputs, list) and len(inputs) == 1:
            return outputs[0]
        return outputs

__call__

Python
__call__(inputs, **kwargs)

Predict the secondary structure of the RNA sequence(s) given as inputs.

Parameters:

Name Type Description Default

inputs

`str` or `List[str]`

One or several RNA sequences.

required

threshold

`float`, *optional*

The threshold to use for determining if a contact is present or not. If not provided, the default is 0.5. The value must be between 0 and 1.

required

output_contact_map

`bool`, *optional*

Whether to output the contact map along with the secondary structure. If not provided, the default is False.

required

matching

`str`, *optional*

Conflict resolver for bases with multiple candidate partners: "greedy" (default) or "blossom".

required
Return

dict or List[dict]: Each result comes as a dictionary with the following keys:

Text Only
1
2
3
- **sequence** (`str`) -- The input RNA sequence.
- **secondary_structure** (`str`) -- The predicted dot-bracket notation string.
- **contact_map** (`np.ndarray`, *optional*) -- The post-processed contact map probabilities.
Source code in multimolecule/pipelines/rna_secondary_structure.py
Python
def __call__(self, inputs, **kwargs):
    """
    Predict the secondary structure of the RNA sequence(s) given as inputs.

    Args:
        inputs (`str` or `List[str]`):
            One or several RNA sequences.
        threshold (`float`, *optional*):
            The threshold to use for determining if a contact is present or not. If not provided, the default is
            `0.5`. The value must be between 0 and 1.
        output_contact_map (`bool`, *optional*):
            Whether to output the contact map along with the secondary structure. If not provided, the default is
            `False`.
        matching (`str`, *optional*):
            Conflict resolver for bases with multiple candidate partners: `"greedy"` (default) or `"blossom"`.

    Return:
        `dict` or `List[dict]`:
            Each result comes as a dictionary with the following keys:

            - **sequence** (`str`) -- The input RNA sequence.
            - **secondary_structure** (`str`) -- The predicted dot-bracket notation string.
            - **contact_map** (`np.ndarray`, *optional*) -- The post-processed contact map probabilities.
    """
    outputs = super().__call__(inputs, **kwargs)
    if isinstance(inputs, list) and len(inputs) == 1:
        return outputs[0]
    return outputs