Skip to content

bpRNA-1m

bpRNA-1m

bpRNA-1m is a database of single molecule secondary structures annotated using bpRNA.

Disclaimer

This is an UNOFFICIAL release of the bpRNA-1m by Center for Quantitative Life Sciences of the Oregon State University.

The team releasing bpRNA-1m did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.

Dataset Description

Example Entry

id sequence secondary_structure structural_annotation functional_annotation
bpRNA_RFAM_1016 AUUGCUUCUCGGCCUUUUGGCUAACAUCAAGU… ......(((.((((....)))).)))...... EEEEEESSSISSSSHHHHSSSSISSSXXXXXX… NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN…

Column Description

The converted dataset consists of the following columns, each providing specific information about the RNA secondary structures, consistent with the bpRNA standard:

  • id: A unique identifier for each RNA entry. This ID is derived from the original .sta file name and serves as a reference to the specific RNA structure within the dataset.

  • sequence: The nucleotide sequence of the RNA molecule, represented using the standard RNA bases:

    • A: Adenine
    • C: Cytosine
    • G: Guanine
    • U: Uracil
  • secondary_structure: The secondary structure of the RNA represented in dot-bracket notation, using up to three types of symbols to indicate base pairing and unpaired regions, as per bpRNA’s standard:

    • Dots (.): Represent unpaired nucleotides.
    • Parentheses (( and )): Represent base pairs in standard stems (page 1).
    • Square Brackets ([ and ]): Represent base pairs in pseudoknots (page 2).
    • Curly Braces ({ and }): Represent base pairs in additional pseudoknots (page 3).
  • structural_annotation: Structural annotations categorizing different regions of the RNA based on their roles within the secondary structure, consistent with bpRNA standards:

    • E: External Loop – Regions that are unpaired and external to any loop or helix.
    • S: Stem – Paired regions forming helical structures.
    • H: Hairpin Loop – Unpaired regions at the end of a stem, forming a loop.
    • I: Internal Loop – Unpaired regions between two stems.
    • M: Multi-loop – Junctions where three or more stems converge.
    • B: Bulge – Unpaired nucleotides on one side of a stem.
    • X: Ambiguous or Undetermined – Regions where the structure is unknown or cannot be classified.
    • K: Pseudoknot – Regions involved in pseudoknots, where base pairs cross each other.
  • functional_annotation: Functional annotations indicating specific functional elements or regions within the RNA sequence, as defined by bpRNA:

    • N: None – No specific functional annotation is assigned.
    • K: Pseudoknot – Marks nucleotides involved in pseudoknot structures, which can be functionally significant.

Variants

This dataset is available in two variants:

  • bpRNA-1m: The main bpRNA-1m dataset.
  • bpRNA-1m(90): bpRNA-1m(90) is a subset of bpRNA-1m containing RNAs with less than 90% sequence similarity.
  • bpRNA-spot: A subset of bpRNA-1m that applies CD-HIT (CD-HIT-EST) to remove sequences with more than 80% sequence similarity from bpRNA-1m.
  • bpRNA-new: A dataset of newly discovered RNA families from Rfam 14.2, designed for cross-family validation to assess generalization capability.

License

This dataset is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

Text Only
SPDX-License-Identifier: AGPL-3.0-or-later

Citation

BibTeX
@article{danaee2018bprna,
  author  = {Danaee, Padideh and Rouches, Mason and Wiley, Michelle and Deng, Dezhong and Huang, Liang and Hendrix, David},
  journal = {Nucleic Acids Research},
  month   = jun,
  number  = 11,
  pages   = {5381--5394},
  title   = {{bpRNA}: large-scale automated annotation and analysis of {RNA} secondary structure},
  volume  = 46,
  year    = 2018
}

@article{cannone2002comparative,
  author    = {Cannone, Jamie J and Subramanian, Sankar and Schnare, Murray N and Collett, James R and D'Souza, Lisa M and Du, Yushi and Feng, Brian and Lin, Nan and Madabusi, Lakshmi V and M{\"u}ller, Kirsten M and Pande, Nupur and Shang, Zhidi and Yu, Nan and Gutell, Robin R},
  copyright = {https://www.springernature.com/gp/researchers/text-and-data-mining},
  journal   = {BMC Bioinformatics},
  month     = jan,
  number    = 1,
  pages     = {2},
  publisher = {Springer Science and Business Media LLC},
  title     = {The comparative {RNA} web ({CRW}) site: an online database of comparative sequence and structure information for ribosomal, intron, and other {RNAs}},
  volume    = 3,
  year      = 2002
}

@article{zwieb2003tmrdb,
  author    = {Zwieb, Christian and Gorodkin, Jan and Knudsen, Bjarne and Burks, Jody and Wower, Jacek},
  journal   = {Nucleic Acids Research},
  month     = jan,
  number    = 1,
  pages     = {446--447},
  publisher = {Oxford University Press (OUP)},
  title     = {{tmRDB} ({tmRNA} database)},
  volume    = 31,
  year      = 2003
}

@article{rosenblad2003srpdb,
  author    = {Rosenblad, Magnus Alm and Gorodkin, Jan and Knudsen, Bjarne and Zwieb, Christian and Samuelsson, Tore},
  journal   = {Nucleic Acids Research},
  month     = jan,
  number    = 1,
  pages     = {363--364},
  publisher = {Oxford University Press (OUP)},
  title     = {{SRPDB}: Signal Recognition Particle Database},
  volume    = 31,
  year      = 2003
}

@article{sprinzl2005compilation,
  author    = {Sprinzl, Mathias and Vassilenko, Konstantin S},
  journal   = {Nucleic Acids Research},
  month     = jan,
  number    = {Database issue},
  pages     = {D139--40},
  publisher = {Oxford University Press (OUP)},
  title     = {Compilation of {tRNA} sequences and sequences of {tRNA} genes},
  volume    = 33,
  year      = 2005
}

@article{brown1994ribonuclease,
  author    = {Brown, J W and Haas, E S and Gilbert, D G and Pace, N R},
  journal   = {Nucleic Acids Research},
  month     = sep,
  number    = 17,
  pages     = {3660--3662},
  publisher = {Oxford University Press (OUP)},
  title     = {The Ribonuclease {P} database},
  volume    = 22,
  year      = 1994
}

@article{griffiths2003rfam,
  author    = {Griffiths-Jones, Sam and Bateman, Alex and Marshall, Mhairi and Khanna, Ajay and Eddy, Sean R},
  journal   = {Nucleic Acids Research},
  month     = jan,
  number    = 1,
  pages     = {439--441},
  publisher = {Oxford University Press (OUP)},
  title     = {Rfam: an {RNA} family database},
  volume    = 31,
  year      = 2003
}

@article{berman2000protein,
  author    = {Berman, H M and Westbrook, J and Feng, Z and Gilliland, G and Bhat, T N and Weissig, H and Shindyalov, I N and Bourne, P E},
  journal   = {Nucleic Acids Research},
  month     = jan,
  number    = 1,
  pages     = {235--242},
  publisher = {Oxford University Press (OUP)},
  title     = {The Protein Data Bank},
  volume    = 28,
  year      = 2000
}

Note

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

BibTeX
@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}