Skip to content

RIVAS

The RIVAS dataset is a curated collection of RNA sequences and their secondary structures, designed for training and evaluating RNA secondary structure prediction methods. The dataset combines sequences from published studies and databases like Rfam, covering diverse RNA families such as tRNA, SRP RNA, and ribozymes. The secondary structure data is obtained from experimentally verified structures and consensus structures from Rfam alignments, ensuring high-quality annotations for model training and evaluation.

Disclaimer

This is an UNOFFICIAL release of the RIVAS dataset by Elena Rivas, et al.

The team releasing RIVAS did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.

Dataset Description

Example Entry

id sequence secondary_structure
AACY020454584.1_604-676 ACUGGUUGCGGCCAGUAUAAAUAGUCUUUAAG… ((((........)))).........((........

Column Description

The converted dataset consists of the following columns, each providing specific information about the RNA secondary structures, consistent with the bpRNA standard:

  • id: A unique identifier for each RNA entry. This ID is derived from the original .sta file name and serves as a reference to the specific RNA structure within the dataset.

  • sequence: The nucleotide sequence of the RNA molecule, represented using the standard RNA bases:

    • A: Adenine
    • C: Cytosine
    • G: Guanine
    • U: Uracil
  • secondary_structure: The secondary structure of the RNA represented in dot-bracket notation, using up to three types of symbols to indicate base pairing and unpaired regions, as per bpRNA’s standard:

    • Dots (.): Represent unpaired nucleotides.
    • Parentheses (( and )): Represent base pairs in standard stems (page 1).
    • Square Brackets ([ and ]): Represent base pairs in pseudoknots (page 2).
    • Curly Braces ({ and }): Represent base pairs in additional pseudoknots (page 3).

Variants

This dataset is available in three variants:

  • RIVAS: Includes TrainSetA (3166 sequences) for training, TestSetA (697 sequences) for validation and TestSetB (430 sequences) for testing.
  • RIVAS-A: Includes TrainSetA (3166 sequences) and TestSetA (697 sequences), emphasizing sequence diversity while minimizing overlap between training and test sets. Suitable for evaluating RNA secondary structure prediction models on diverse RNA families.
  • RIVAS-B: Consists of TrainSetB (1094 sequences) and TestSetB (430 sequences) derived from Rfam alignments, offering additional structural diversity and RNA types not present in RIVAS-A. Designed for testing the generalization capability of models trained on different types of RNA structures.
  • bpRNA-spot: A subset of RIVAS that applies CD-HIT (CD-HIT-EST) to remove sequences with more than 80% sequence similarity from RIVAS.
  • RNAStrAlign: A database of RNA secondary with the same families as ArchiveII, usually used for training.

License

This dataset is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

Text Only
SPDX-License-Identifier: AGPL-3.0-or-later

Citation

BibTeX
@article{rivas2012a,
  author    = {Rivas, Elena and Lang, Raymond and Eddy, Sean R},
  journal   = {RNA},
  month     = feb,
  number    = 2,
  pages     = {193--212},
  publisher = {Cold Spring Harbor Laboratory},
  title     = {A range of complex probabilistic models for {RNA} secondary structure prediction that includes the nearest-neighbor model and more},
  volume    = 18,
  year      = 2012
}

Note

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

BibTeX
@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}